Biotechnology is an area of science that encompasses biological systems and living organisms in order to make or modify products or processes. Various processes related to biotechnology such as research and development, documentation, etc. can be outsourced to freelancers. Expert freelancers with biotechnology knowledge and qualifications are available to bid on projects. To get started, post your job today. Biotechnology Experts anheuern

Filter

Meine letzten Suchanfragen
Filtern nach:
Budget
bis
bis
bis
Typ
Fähigkeiten
Sprachen
    Jobstatus
    10 Gefundene Jobs, Preise in EUR
    Genomics Variants Exploration -- 2 6 Tage left
    VERIFIZIERT

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    €5 / hr (Avg Bid)
    €5 / hr Gebot i.D.
    3 Angebote

    I need help solving 2 organic chemistry questions for today!

    €6 / hr (Avg Bid)
    €6 / hr Gebot i.D.
    20 Angebote
    Project on vaccine and viruses 3 Tage left
    VERIFIZIERT

    Different research and report on vaccines for viruses

    €119 (Avg Bid)
    €119 Gebot i.D.
    35 Angebote
    Expression of protein-coding genes 3 Tage left
    VERIFIZIERT

    Research on several levels including chromatin organisation, transcription, RNA processing, translation and cis-regulatory elements.

    €126 (Avg Bid)
    €126 Gebot i.D.
    10 Angebote
    Naming logo 3 Tage left

    Naming para dos emprendimientos. Ambos nombres deben estar en inglés o bien ser nombres inventados. Ambos nombres están relacionados al cuidado de la salud.

    €21 (Avg Bid)
    €21 Gebot i.D.
    38 Angebote

    Hello - I am looking for a skilled MEDICAL WRITER with experience in regulatory submissions, Phase 1 through 4 clinical study reports, regulatory submissions, investigator brochures, NDA documents and more. Rare disease writing is a plus but you MUST have at least 3 years experience in oncology writing. You MUST have regulatory writing experience. You must speak and write fluent English. You ...

    €34 / hr (Avg Bid)
    €34 / hr Gebot i.D.
    17 Angebote

    Hello I need an expert in Organic Chemistry. Please apply if you have the right expertise.

    €73 (Avg Bid)
    €73 Gebot i.D.
    22 Angebote

    We need to develop an efficient and effective algorithm for facial recognition and Liveness detection with AI capabilities.

    €4201 - €8403
    €4201 - €8403
    0 Angebote

    I need you to write a research article.

    €11 / hr (Avg Bid)
    €11 / hr Gebot i.D.
    14 Angebote
    Biology experiment 14 Stunden left
    VERIFIZIERT

    need help in Biology Lab Enzymes

    €24 (Avg Bid)
    €24 Gebot i.D.
    34 Angebote